Plant growth condition

One wild bird-eye chili pepper line (TV3) found in Tra Vinh province and ten commercial cultivars (CN404, HNCS, CP01, HNN1, SGX5, SGX6, HN7777, TN535, HNNS, and PN400) were used in this study. Seeds from eleven cultivars were sown on small soil pots. At the 4-leaf stage, individual seedlings were transferred to pots with 18 cm in diameter. Plants were watered every morning with 2 l of water. Nutrients were supplied to each plant every two weeks with 250 ml of 1/10 MS (Murashige & Skoog) mineral solution. Plants were kept in a net house to avoid insects. Plants that were infected by mealybug were isolated and treated with insecticide (Bihopper 207EC, Binh Dien – Mekong limited company) until recovered.

Isolation of pathogenic fungi species

Fruits showing anthracnose symptoms (e.g., rounded necrosis spots on the fruit) were collected from chili pepper fields in Tra Vinh province. Infected fruit samples were washed five times by shaking in sterile water and dried under a laminar airflow chamber prior to surface sterilization with 70% ethanol for 2 min. The 0.5 cm x 0.5 cm fruit tissues containing the infected region were transferred to potato dextrose agar (PDA, 4% potato starch, 2% dextrose, 1.5% agar) plates kept at 25 C under 16 h light/8 h dark condition in an incubation room for seven days. Purified fungal strains were obtained after three consecutive sub-cultures on PDA plates. The pure fungal cultures were maintained on PDA plates for identification and pathogenicity test.

Morphological analysis of isolated pathogenic fungi species

Pure cultures isolated from infected fruits were first morphologically analyzed to identify the putative strains. The morphology of the fungi strains was analyzed by observing fungal colonies grown on PDA plates, conidia form, and the appressoria formation. For appressoria preparation, a small piece of thin PDA medium was prepared on a sterile glass microscopy slide. A small spore fragment taken from the fungal culture was distributed to four corners of the PDA medium prepared on the slide that was then sealed by a glass coverslip and placed on a sterile wet filter paper in a petri dish to maintain the humidity. After 14 days, the appressoria, which developed under the coverslips, were collected and placed on a glass slide for observation under a light microscope 1. The identification of putative strains was based on the description of Than . (2008) 17.

Identification of pathogenic fungi species via sequencing

Based on the morphological characterization, the putative samples grown on PDA medium were sent to the PHUSA Biochem LTD. company for sequencing, using the ITS1 primer (CTTGGTCATTTAGAGGAAGTAA). The sequenced ITS regions were used for the sequence homology analysis. To identify species, the sequencing results of the putative samples were used to BLAST with sequences available from GenBank Nucleotide database of NCBI (National Center for Biotechnology Information)

Pathogenicity test

The two isolated strains were used to study the anthracnose resistance of eleven chili pepper cultivars. isolates were incubated on PDA medium at 25 C for 14 days. To collect the fungal conidia, 5 ml of sterile water was added directly on the culture surface, followed by gently shaking of the petri dish. The conidia suspensions were collected to 1.5-ml tubes and centrifuged at 10000 rpm. The pellets that contained the concentrated conidia, was adjusted with sterile water to 10 conidia per ml using a hemocytometer.

For the pathogenicity test, the experiment was performed twice to confirm the phenotype. In each replicate, two to six fully developed green fruits from each cultivar were injected with 10 µl of the conidia suspensions (10 conidia per ml). Sterile water-infiltrated fruits were used as control. Three technical replicates were performed by injecting on three different places of a fruit of the cultivar that had medium or large fruits. To develop the disease, inoculated fruits were secured in plastic containers lined with wet paper towels and incubated for seven days at 25 °C. The development of disease symptoms was observed, and the lesion diameter was measured every 24 h. The lesion diameter was determined by averaging the largest and the smallest diameters of each lesion. The mean of lesion diameters at seven days after injection were used to determine the resistance of eleven chili pepper cultivars to the particular fungal isolate. Data of lesion diameter from two replicates were statistically analyzed using analysis of variance (P < 0.05), followed by multiple range tests using Tukey’s HSD test with SPSS 16.0 software (IBM).

Plant DNA extraction and PCR amplification

The genomic DNA of chili pepper was extracted using the CTAB method 18. The DNA quality and purity were determined by nanodrop (ND-2000, Thermo Scientific). To verify the presence of anthracnose resistance-associated markers in different chili pepper cultivars, polymerase chain reactions (PCRs) were performed using primers listed in Table 1. PCRs using Taq DNA polymerase and other components were prepared according to the manufacturer’s instruction (BIO-21105, Bioline). The thermal cycle was started with a denaturation step at 95 C for 5 min, followed by 35 cycles of 95 C 30 s, 60 C 30 s, 72 C 1 min, and ended by a 2-min extension step at 72 C. Reactions were held at 4 C. Depending on the product size, 2 to 4% agarose gel was used to migrate DNA under 150 V constant voltage for 50 min. DNA was then visualized under UV light, and DNA size was determined according to the 100-bp ladder (SM0241, Thermo Scientific).

Isolates obtained from infected fruits

From the infected fruits collected from chili pepper fields in Tra Vinh province, five different fungal isolates were obtained. Among these isolates, two putative strains, named 18T and 21T, were identified. The morphology analysis was performed according to the morphological descriptions of species outlined by Than . (2008) 17.

Colonies of the 18T strain grown on PDA showed pale orange color with fluffy aerial mycelia on the colony surface (Figure 1 A). Conidia of the 18T isolate were smooth-walled, transparent, colorless straight, cylindrical form with uneven ends. The size of the conidia was 10 – 14-µm long and 3 – 4-µm wide. The 18T appressoria were ovoid to ellipsoidal, 6 – 9-µm long, 4 – 6-µm wide, with medium to dark brown color. On the other hand, the colonies of the 21T strain grown on PDA were grey to pale orange with thin cottony mycelia on the surface (Figure 1 B). The 21T isolate produced fusiform conidia with both acute ends, 7 – 13-µm long and 3 – 4-µm wide. Most of the 21T appressoria were irregularly shaped, 5 – 8-µm long, 3 – 4-µm wide.

The species of the two putative isolates were identified by sequencing the ITS region using the ITS1 primer. The sequencing result successfully confirmed the prediction that was based on the morphology observation. By comparing with the sequence database from NCBI, the ITS sequences of the 18T and 21T isolates showed the highest similarity to (Accession number: MH603141.1) and (Accession number: MF629920.1), respectively (data not shown). Therefore, together with the morphology observation, the 18T and 21T isolates were identified as and , respectively. These two fungal strains were later used in the experiment to determine the anthracnose resistance of different chili pepper cultivars.

Pathogenicity testing

Fruits from 11 chili pepper cultivars were infected with the two isolates of species, and . Both isolates were pathogenic and could successfully infect most of the cultivars. The infected areas were all rounded-shape with concentric acervuli (Figure 2 A). The lesion diameters of the eleven cultivars injected with the two isolates were described in table 2. The water-injected fruits significantly showed no lesion in eleven cultivars at seven days after injection (Figure 2). When injected with the conidia, the lesion diameters were all significantly larger than their corresponding water-injected controls (Figure 2 B). There were also significant differences in lesion diameter among eleven cultivars. The two cultivars, including CN404 and HNCS showed the strongest resistance to both species with the smallest infection diameter, smaller than 3 mm. In these cultivars, larger lesion diameters when infected by compared to that infected by indicated that they were more resistant to. Additionally, TN535 and HNNS were the two most susceptible cultivars to both species due to their large lesion diameters when infected by these two pathogens. The resistance level to was similar to in each cultivar, with the exception of the TV3 and PN400 cultivars (Figure 2 B). TV3 was strongly resistant to (3 mm in lesion diameter), but moderately resistance to (6 mm in lesion diameter) The PN400 cultivar, on the other hand, was susceptible to the (11.5 mm in lesion diameter) but showed the moderate resistance to (7.5 mm in lesion diameter).

Potential anthracnose resistance-associated molecular markers

Four different PCR-based molecular markers (SSR markers), were tested to determine the potential molecular marker related to the anthracnose resistance in Vietnamese chili pepper cultivars. PCRs were performed for eleven chili pepper cultivars, and the summary of results was presented in table 2. Among the four tested molecular markers, HpmsE032, HpmsE047, and HpmsE116 were detected in both resistant and susceptible cultivars indicating these markers are not associated with the anthracnose resistance caused by defined species (Figure 3 B-D). Interestingly, the HpmsE126 marker was observed only in two of three anthracnose resistant cultivars, CN404 and TV3 (Figure 3 A). These two chili pepper cultivars carrying HpmsE126 showed very strong resistance to anthracnose since their lesion diameter was significantly lower than the lesion diameter in the cultivars without this marker. The data analysis also suggested that having HpmsE126 marker might contribute more to resistance than resistance (Figure 4).

Among the markers showing differences between cultivars, HpmsE126 was observed in the two cultivars, CN404 and TV3, which had a very strong resistance to anthracnose, especially the disease caused by . As a result, the HpmsE126 might be related to the resistance to anthracnose and would be a potential molecular marker used in chili pepper breeding. Given that these chili pepper cultivars showed stronger resistance to compared to , the HpmsE126 marker might be more related to the resistance in chili pepper. Interestingly, it must be noticed that the HNCS cultivar was among the best anthracnose resistant cultivars in this study, although the HpmsE126 marker was not found in this cultivar (Figure 3 A).